Abstract
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host
Original language | English |
---|---|
Pages (from-to) | 374-384 |
Journal | Microbiology |
Volume | 156 |
Issue number | 2 |
DOIs | |
Publication status | Published - 2010 |
Keywords
- deficient escherichia-coli
- heat-shock response
- bacillus-subtilis
- cell-division
- dna-polymerases
- antibiotic ciprofloxacin
- gene-expression
- reca protein
- identification
- replication
Fingerprint
Dive into the research topics of 'The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis'. Together they form a unique fingerprint.Datasets
-
Listeria monocytogenes SOS response determined after mitomycin C exposure
van der Veen, S. (Creator), van Schalkwijk, S. (Creator), Molenaar, D. (Creator), de Vos, W. (Creator), Abee, T. (Creator) & Wells-Bennik, M. H. J. (Creator), Wageningen University, 25 Nov 2009
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE12634
Dataset